View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_high_28 (Length: 237)
Name: NF4654_high_28
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 39032707 - 39032912
Alignment:
| Q |
16 |
gttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgttaattttaaggataatgctacttctctcgacatattttctagcaaaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
39032707 |
gttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgttaattttaaggataatgctacttctcgcgacata-tttctagcaaaaa |
39032805 |
T |
 |
| Q |
116 |
gatgacgaccttgttgctagnnnnnnnnattgcaactacaattaatcaactctttcttttttatccaaccacccatgatgtccaccaatttagatctaac |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39032806 |
gatgacgaccttgttgctag-tttttttattgcaactac----aatcgactctttcttttttatccaaccacccatgatgtccaccaatttagatctaac |
39032900 |
T |
 |
| Q |
216 |
ggtgacattctt |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39032901 |
ggtgacattctt |
39032912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University