View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_high_30 (Length: 220)
Name: NF4654_high_30
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 86 - 203
Target Start/End: Complemental strand, 11369285 - 11369167
Alignment:
| Q |
86 |
taccctaaaggtaggtttaaagaataacattttt-aagacaaaatgatatcaaacatgattaattaaataatccaaaataactaagtcaaacttattata |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11369285 |
taccctaaaggtaggtttaaagaataacatttttgaagacaaaatgatatcaaacatgattaattaaataatccaaaataactaagtcaaacttattata |
11369186 |
T |
 |
| Q |
185 |
tccagtgatataatgcctg |
203 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11369185 |
tccagtgatataatgcctg |
11369167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 47
Target Start/End: Complemental strand, 11369355 - 11369323
Alignment:
| Q |
15 |
attcttcaaatcaatgtaaacaactcctgcaaa |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
11369355 |
attcttcaaatcaatgtaaacaactcctgcaaa |
11369323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University