View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_low_13 (Length: 281)
Name: NF4654_low_13
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 112 - 266
Target Start/End: Original strand, 27791876 - 27792030
Alignment:
| Q |
112 |
gatctagatccaaaaattgaggatgtgccatatgcatgaatgcggcaaatttgggactgcagggaatcctgggcatgacagtaaagttaagctttacatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27791876 |
gatctagatccaaaaattgaggatgtgccatatgcatgaatacggcaaatttgtgactgcagggaatcctgggcatgacagtaaagttaagctttacatc |
27791975 |
T |
 |
| Q |
212 |
tgtgacagaagagttccactagatgtgaaagcaaggctaaattagttagtacatc |
266 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27791976 |
tggggcagaagagttccactagatgtgaaagcaaggataaattagttagtacatc |
27792030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 27791838 - 27791900
Alignment:
| Q |
19 |
acaaatttgctgcattcatgcattcagcacataagcccgatttagatccaaaaattgaggatg |
81 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27791838 |
acaaatttgccacattcatgcattcagcacataagcctgatctagatccaaaaattgaggatg |
27791900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University