View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_low_14 (Length: 281)
Name: NF4654_low_14
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 22 - 276
Target Start/End: Complemental strand, 31597292 - 31597038
Alignment:
| Q |
22 |
ttttgattttttcgagtgatttttgttataggctccctataatgtgctattttacaaggataaaccaagactaggaactgctttggagttgcttaaagct |
121 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31597292 |
ttttgatttttttgagtgatttttgttataggctccctataatgtgctattttacaaggataagccaagactaggaactgctttggagttgcttaaagct |
31597193 |
T |
 |
| Q |
122 |
acacaagagctagaacaaagattggaagaagtaaacttttccatcttagttactttcttaatttagtacaatttaatcacnnnnnnnctccttaatatga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31597192 |
acacaagagctagaacaaagattggaagaagtaaacttttccatcttagttactttcttaatttagtacaatttaatcactttttttctccttaatatga |
31597093 |
T |
 |
| Q |
222 |
agatcaactttacatatatataatattctgaataagaatttaataggaatatatt |
276 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31597092 |
agatcagctttacatatatataatattctaaataagaatttaataggaatatatt |
31597038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 19577701 - 19577733
Alignment:
| Q |
1 |
cgtgaaaatttggcggtattgttttgatttttt |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
19577701 |
cgtgaaaatttggcggtattgttgtgatttttt |
19577733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University