View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_low_17 (Length: 258)
Name: NF4654_low_17
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 3 - 243
Target Start/End: Complemental strand, 36540052 - 36539816
Alignment:
| Q |
3 |
tatagaattgagtctgaccgaatcaaactcaattttcaccaccgcataatcaaacacacaccgagtggccttacccttcacaaccctgtatttgtatcaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36540052 |
tatagaattgagtctgaccgaatcaaactcaattttcaccaccgcataaccaaacacacaccgagtggccttacccttcacaaccctatatttgtatcaa |
36539953 |
T |
 |
| Q |
103 |
aggcttaactactaaccatatattgattttggaacagatcaaggtgtatttgggacactaaaaccccaatcagaatatgtattgttacctaatctagtgg |
202 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36539952 |
aggcttaactactaaccatatatt----ttggaacagatcaaggtgtatttgggacactaaaaccccaatcagaatatgtattgttacctaatctagtgg |
36539857 |
T |
 |
| Q |
203 |
caaaagtttcaaatcatttgaaaccatcacaaatgtctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36539856 |
caaaagtttcaaatcatttgaaaccatcacaaatgtctctg |
36539816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 63
Target Start/End: Original strand, 35550332 - 35550372
Alignment:
| Q |
23 |
aatcaaactcaattttcaccaccgcataatcaaacacacac |
63 |
Q |
| |
|
||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
35550332 |
aatcaaaatcaattttcgccaccgcaaaatcaaacacacac |
35550372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University