View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_low_21 (Length: 248)
Name: NF4654_low_21
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 25 - 151
Target Start/End: Complemental strand, 25064421 - 25064293
Alignment:
| Q |
25 |
tgttctcttctgcagaatcaaatcattctcttgctacaactaaaattatgctaatgccagaaagaaagaaaaaa---ttagaactgaaagttcaaggctt |
121 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25064421 |
tgttctcttctgcagaagcaaatcattctcttgctacaactaaaattatgctaatgccagaa-gaaagaaaaaaaaattagaactgaaagttcaaggctt |
25064323 |
T |
 |
| Q |
122 |
tacttaaaatgctatgtatttcatttagtt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25064322 |
tacttaaaatgctatgtatttcatttagtt |
25064293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 176 - 247
Target Start/End: Complemental strand, 25064276 - 25064205
Alignment:
| Q |
176 |
gtctattttaaagttccaagagtttatatgtgtaaactaatttctgttttgtagaggaccaaattgattttt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25064276 |
gtctattttaaagttccaagagtttatatgtgtaaactaatttctgttttgtagaggaccaaattgattttt |
25064205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University