View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4654_low_28 (Length: 237)

Name: NF4654_low_28
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4654_low_28
NF4654_low_28
[»] chr7 (1 HSPs)
chr7 (16-227)||(39032707-39032912)


Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 39032707 - 39032912
Alignment:
16 gttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgttaattttaaggataatgctacttctctcgacatattttctagcaaaaa 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||    
39032707 gttattatggattagcgtatggcttgttcttgaatgaagttaacaatcttgttaattttaaggataatgctacttctcgcgacata-tttctagcaaaaa 39032805  T
116 gatgacgaccttgttgctagnnnnnnnnattgcaactacaattaatcaactctttcttttttatccaaccacccatgatgtccaccaatttagatctaac 215  Q
    ||||||||||||||||||||        |||||||||||    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
39032806 gatgacgaccttgttgctag-tttttttattgcaactac----aatcgactctttcttttttatccaaccacccatgatgtccaccaatttagatctaac 39032900  T
216 ggtgacattctt 227  Q
    ||||||||||||    
39032901 ggtgacattctt 39032912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University