View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4655-Insertion-7 (Length: 115)
Name: NF4655-Insertion-7
Description: NF4655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4655-Insertion-7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 2e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 29786333 - 29786225
Alignment:
| Q |
8 |
tttctaacatttgctatctaatttttt-gttactcaaaattttcacctgaactgcttgaacttgaaggcaaattgcatatttcaccggcccaacaggtac |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29786333 |
tttctaacatttgctatctaatttttttgttactcaaaattttcacctgaactgcttgaacttgaaggcaaattgcatatttcaccggcccaacaggtac |
29786234 |
T |
 |
| Q |
107 |
ggttgctct |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
29786233 |
ggttgctct |
29786225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University