View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4655_high_2 (Length: 337)
Name: NF4655_high_2
Description: NF4655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4655_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 52 - 204
Target Start/End: Complemental strand, 35549252 - 35549099
Alignment:
| Q |
52 |
caatttagtaacttatttgaatgatctttaggacttactctttgaataaaagattatatttatgattggtcatacctaaggcatat-aaataataacata |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || || |
|
|
| T |
35549252 |
caatttagtaacttatttgaatgatctttaggatttactctttgaataaaagattatatttatgattggtcatacctaaggcatataaaatctaaatcta |
35549153 |
T |
 |
| Q |
151 |
aataaaccgttttcttatcaaaagcaatcccaaaaagaaaccttctcatcattt |
204 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35549152 |
aacaaaccgttttcttatcaaaagcaatcccaaaaagaaaccttctcatcattt |
35549099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 261 - 320
Target Start/End: Complemental strand, 35549045 - 35548986
Alignment:
| Q |
261 |
gattttgttacaattttaagataatcactcatcttttaattgattattattaattgattt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35549045 |
gattttgttacaattttaagataatcactcaccttttaattgattattattaattgattt |
35548986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University