View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4655_low_6 (Length: 246)
Name: NF4655_low_6
Description: NF4655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4655_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 56 - 136
Target Start/End: Complemental strand, 39313776 - 39313694
Alignment:
| Q |
56 |
gaagaaagaatcccacaagcaaagtttcccttttgagacacttttctctttcctttatactctt--cccactccacaaggttc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39313776 |
gaagaaagaatcccacaagcaaagtttcccttttgagacacttttctctttcctttatactcttcccccactccacaaggttc |
39313694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University