View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4656_low_4 (Length: 293)

Name: NF4656_low_4
Description: NF4656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4656_low_4
NF4656_low_4
[»] chr4 (1 HSPs)
chr4 (190-269)||(44473798-44473877)


Alignment Details
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 190 - 269
Target Start/End: Complemental strand, 44473877 - 44473798
Alignment:
190 tggtttgcttttaccccattgcttaggtgttaggtcgatctccttttctcctctccgacttttctgttattctaatcgca 269  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||    
44473877 tggtttgcctttaccccattgcttaggtgttaggtcgatctccttttctcctctccgacttttctattcttctaatcgca 44473798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University