View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4656_low_7 (Length: 233)
Name: NF4656_low_7
Description: NF4656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4656_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 30371560 - 30371345
Alignment:
| Q |
1 |
tacttcattgttttggtgtacacgcaaatttggtgactttggttttgttgttttagaaatgcagctagttttgaaagtattcaaaagtagaataattgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30371560 |
tacttcattgttttggtgtacacgcaaatttggtgactttggttttgttgttttagaaatgcagctagttttgaaagtattcaaaagtagaataattgga |
30371461 |
T |
|
| Q |
101 |
ggcaatgttgcacactaggcaattggaatattaacctatctatgagaatatataatattgtttcagttacaaatgatannnnnnnncatctgaactgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30371460 |
ggcaatgttgcacactaggcaattggaatattaacctatctatgagaatatataatattgtttcagttacaaatgatattttttttcatctgaactgata |
30371361 |
T |
|
| Q |
201 |
tgctgctagactgcta |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30371360 |
tgctgctagactgcta |
30371345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 12 - 58
Target Start/End: Original strand, 30360248 - 30360294
Alignment:
| Q |
12 |
tttggtgtacacgcaaatttggtgactttggttttgttgttttagaa |
58 |
Q |
| |
|
||||| |||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30360248 |
tttggagtacacgcaagtttggtgacttgggttttgttgttttagaa |
30360294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University