View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4657-Insertion-15 (Length: 311)
Name: NF4657-Insertion-15
Description: NF4657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4657-Insertion-15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 8 - 307
Target Start/End: Complemental strand, 21829762 - 21829463
Alignment:
| Q |
8 |
taattaaccttattagtgggggatatgcatcttcctgttcttagcgcagacctgtcacttaccttgggctacaattatctttgatgattgttgaattgca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21829762 |
taattaaccttattagtgggggatatgcatcttcctgttcttagcgcagacctgtcacttaccttgggctacaattatctttgatgattgttgaattgca |
21829663 |
T |
 |
| Q |
108 |
tctaggaggtatcagatgagattgttagtttgctagcctcctttaaagggaggagtctattgattatctaggttataggacactatggctgggatcaaat |
207 |
Q |
| |
|
||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21829662 |
tctagaatgtatcagatgagattgttagtttggtagcctcctttaaagggaggagtctattggttatctaggttataggacactatgtctgggatcaaat |
21829563 |
T |
 |
| Q |
208 |
gtgaaggtagaatcgtcatcaatccatcacggggttagtttcaattttagtttggaggtgatgataaaattgttcttttgtcaatcaaatggggctaggt |
307 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21829562 |
gtgaaggtagaatcgtcatggatccatcacggggttagtttcaattttagtttggaggtgatgacaaaattgttcttttgtcaatctaatggggctaggt |
21829463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University