View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4657_high_13 (Length: 322)
Name: NF4657_high_13
Description: NF4657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4657_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 14 - 305
Target Start/End: Complemental strand, 21830049 - 21829758
Alignment:
| Q |
14 |
ttctaagggagatcatcttcatacgaggaaatctcataagataatgacctgcaatgggaacgtctcaatggagaattgtcatcattacaacaaactccat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21830049 |
ttctaagggagatcatcttcatacgaggaaatctcataagataatgacctgcaataggaacgtctcaatggagaattttcatcattacaacaaactccat |
21829950 |
T |
|
| Q |
114 |
gccccataggagcgaggggagggagggttggaggtttcatatagtatttaacattatggcgttgaggggactaggacggtggacgatgatgggggtctta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21829949 |
gccccataggagcgaggggagggagggttggaggtttcatatagtatttaacattatggcgttgaggggactaggacggtggacgatgatgggggtctta |
21829850 |
T |
|
| Q |
214 |
gactctaaatctttcggggacaaaaaatgtcgtgtcttttcgccaacagtccatgttctagtgtgattttggagtgcgtgtgatttctaatt |
305 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
21829849 |
gactttaaatctttcggggacaaaaaatgtcgtgtcttttcgccaacggtccatgttctagtgtgtttttggtgtgcgtgcgatttctaatt |
21829758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University