View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4657_high_19 (Length: 283)
Name: NF4657_high_19
Description: NF4657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4657_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 15 - 261
Target Start/End: Complemental strand, 41038947 - 41038696
Alignment:
| Q |
15 |
agatgaaactacatgtctttttagaactcttcaatggatgagagaattaggcctacataatgtatttattagtttgattactagacgatcgtaaatggcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41038947 |
agatgaaactacatgtctttttagaactcttcaatggatgagagaattaggcctacataatgtatttattagtttgattactagacgatcgtaaatggcc |
41038848 |
T |
 |
| Q |
115 |
ttcatgagctgcttgatcagggctctgaatttgatatggtatcttgaatttttgcaattttatatttagttcttttataaacaaatggtgtaact----- |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41038847 |
ttcatgagctgcttgatcagggctctgaatttgatatggtatcttgaatttttgcaattttatatttagttcttttataaacaaatggtgtaactcactc |
41038748 |
T |
 |
| Q |
210 |
tttaggaagggagataacatttatggctaatgccaatgatttttattatcta |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41038747 |
tttaggaagggagataacatttatggctaatgccaatgatttttatcatcta |
41038696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University