View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4657_high_31 (Length: 237)
Name: NF4657_high_31
Description: NF4657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4657_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 12 - 222
Target Start/End: Original strand, 52013088 - 52013298
Alignment:
| Q |
12 |
tttgaaaagaccaaaaaagattgctcattggttttaacataatgcttcaattgctattacaaaaacaaaacccgacacaaattcaataatacnnnnnnnn |
111 |
Q |
| |
|
||||| |||||| ||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52013088 |
tttgacaagacctaaaaagacttctcattgggtttaacataatgcttcaattgctattacaaaaacaaaacccgacacaaattcaataatactttttttc |
52013187 |
T |
|
| Q |
112 |
nnnnnnnnncataataacatttttacaataatatggaaattgttctctccatataaatcttataaaatgnnnnnnnattccctttgaaccttcaactctt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
52013188 |
tttttctttcataataacatttttacaataatatggaaattgttctctccatataaatcttataaaatgtttttttattcactttgaaccttcaactctt |
52013287 |
T |
|
| Q |
212 |
cacccataaat |
222 |
Q |
| |
|
||||||||||| |
|
|
| T |
52013288 |
cacccataaat |
52013298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University