View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4657_low_19 (Length: 289)
Name: NF4657_low_19
Description: NF4657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4657_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 23 - 135
Target Start/End: Original strand, 33714393 - 33714505
Alignment:
| Q |
23 |
aagttgtttatccaaatagggtcatattaggtgtcacaacttattgaccatctactgaattttaacgtgattaaccttgattttcaataaaattactgtt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33714393 |
aagttgtttatccaaatagggtcatatttggtgtcacaacttattgaccatctactgaattttaacgtgattaaccttgattttcaataaaattactgtt |
33714492 |
T |
 |
| Q |
123 |
atccaatatggcc |
135 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33714493 |
atccaatatggcc |
33714505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 207 - 277
Target Start/End: Original strand, 33714577 - 33714647
Alignment:
| Q |
207 |
attatcgccgtgttgaagaaggaaaaccttatcctgtgctttgcagaagattagctagcttgaatgatgat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33714577 |
attatcgccgtgttgaagaaggaaaaccttatcctgtgctttgcagaagattagctagcttgaatgatgat |
33714647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University