View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4657_low_33 (Length: 238)
Name: NF4657_low_33
Description: NF4657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4657_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 12974992 - 12975208
Alignment:
| Q |
1 |
gtaatatattatgtcatcaagataagtgtaagtcatcaaagattgtgaacttccaaattttcttaattggagtttgcgtttccaattattggtgcttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12974992 |
gtaatatattatgtcatcaagataagtgtaagtcatcaaagagtgtgaacttccaaatcttcttaattggagttagggtttccaattattggtgcttatg |
12975091 |
T |
 |
| Q |
101 |
gaatactaatagtactgcagttaaaattttattccaaggtgacttgcaagcacgaataattttgctttgcagataaagattcaatcatggcgttgattta |
200 |
Q |
| |
|
|||||| ||||||| || ||||||| |||||||||||||||||||| | | |||||||||| || ||||||| || |||||||||| ||||||| | |
|
|
| T |
12975092 |
gaatac---tagtacttcaaataaaattatattccaaggtgacttgcaatcgccaataattttggttaccagataatgactcaatcatggggttgattca |
12975188 |
T |
 |
| Q |
201 |
tgaatatgatggggaaaata |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
12975189 |
tgaatatgatggggaaaata |
12975208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University