View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4657_low_36 (Length: 230)

Name: NF4657_low_36
Description: NF4657
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4657_low_36
NF4657_low_36
[»] chr4 (1 HSPs)
chr4 (17-215)||(36164102-36164300)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 215
Target Start/End: Original strand, 36164102 - 36164300
Alignment:
17 atatataactcatttttgtggctcaaccactagcagtttggccctatgatcacaaattacttagcttggtaaaagaacattgctgaattgccttggatta 116  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
36164102 atatataactcatttttgtggctcaaccactagcaggttggccctatgatcacaaattacttagcttggtaaaagaacattgctgaatttccttggatta 36164201  T
117 gtttaattagaatttagaactactaatcctaaaggtttagcctttagcaacgtggtcacattacataaaataagaatctgtgactaacgcagaataatg 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
36164202 gtttaattagaatttagaactactaatcctaaaggtttagcctttagcaacgtggtcacattacataaaataagaatctgtgactagcgcagaataatg 36164300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University