View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658-Insertion-17 (Length: 114)
Name: NF4658-Insertion-17
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658-Insertion-17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 32286019 - 32286125
Alignment:
| Q |
8 |
gtattttgagtggggagttgatgtatccatcagtagagatgtgaattgcaaactatccatttcaggctatttttctgctcagcaaatttgtttggactgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32286019 |
gtattttgagtggggagttgatgtatccatcagtagagatgtgaattgcaaactatccatttcaggctatttttctgctcagcaaatttgtttggactgt |
32286118 |
T |
|
| Q |
108 |
tgctgta |
114 |
Q |
| |
|
||||||| |
|
|
| T |
32286119 |
tgctgta |
32286125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University