View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658-Insertion-21 (Length: 359)
Name: NF4658-Insertion-21
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658-Insertion-21 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 5 - 359
Target Start/End: Original strand, 47895740 - 47896078
Alignment:
| Q |
5 |
acaaaattcacattggatatattatctttttaacggttgccctcacgcaacatactaccaagaaaggggaacatcaagagaattattcatttttgtctat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47895740 |
acaaaattcacattggatatattatctttttaacggttgccctcacgcaacatacta---agaaaggggaacatcaagagaattattaatttttgtctat |
47895836 |
T |
 |
| Q |
105 |
gtttatgagtgatgatgacgaatagctaatcagcctaaatgccaagattgctgacttcacatgcttcttttataaacaatacaaattattttcttaataa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47895837 |
gtttatgagtgatgatgacgaatagctaatcagcctaaatgccaagattgctgacttcacatgcttcttttataaacaatacaaattattttcttaataa |
47895936 |
T |
 |
| Q |
205 |
taaaaatatctgtcaaacttttcttttgatggttttggccatctggttttgaccatcaacttatcttgaactcccttgtattatttcacttataaggcat |
304 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47895937 |
taaaaatatctgtcaaacttttcttttga--------------tggttttgaccatcaacttgttttgaactcccttgtattatttcacttataaggcat |
47896022 |
T |
 |
| Q |
305 |
ggttagtgtttattgtttcatccaaggtaccaaa-ttttttaggaccaaccctgta |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47896023 |
ggttagtgtttattgtttcatccaaggtaccaaatttttttaggaccaaccctgta |
47896078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University