View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658-Insertion-25 (Length: 52)
Name: NF4658-Insertion-25
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658-Insertion-25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 16 - 48
Target Start/End: Complemental strand, 35980297 - 35980265
Alignment:
| Q |
16 |
gtacaagagaagtttgtacatgattttggtaat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35980297 |
gtacaagagaagtttgtacatgattttggtaat |
35980265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University