View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_high_19 (Length: 284)
Name: NF4658_high_19
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_high_19 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 63 - 284
Target Start/End: Original strand, 42279925 - 42280146
Alignment:
| Q |
63 |
taataattgactgtggttttcatttcaagatgagcttatcaagaatgccaagtatatagccacccctggcaagggtatcttggcagcagatgagagcact |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42279925 |
taataattgactgtggttttcatttcaagatgagcttatcaagaatgccaagtatatagccacccctggcaagggtatcttggcagcagatgagagcact |
42280024 |
T |
|
| Q |
163 |
ggaactattggcaagcgtctagcaagcatcaacgttgagaacattgaggctaaccgtcaagccctccgtgaacttctcttcacctctcccactgcactcc |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42280025 |
ggaactattggcaagcgtctagcaagcatcaacgttgagaacattgaggctaaccgtcaagccctccgtgaacttctcttcacctctcccaatgcactcc |
42280124 |
T |
|
| Q |
263 |
aataactctccggtgtcatcct |
284 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
42280125 |
aatacctctccggtgtcatcct |
42280146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 42279807 - 42279846
Alignment:
| Q |
13 |
tagggtgagagttattttaggacagagggagtaacttgaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42279807 |
tagggtgagagttattttaggacagagggagtaacttgaa |
42279846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University