View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_high_25 (Length: 247)
Name: NF4658_high_25
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 35980300 - 35980523
Alignment:
| Q |
18 |
atattgaggtgcttgaaggtactctatatactccacagaccacaccacaacaatgaccacataaaaagcttcatgataatttctcattccaccctctcat |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35980300 |
atattgaggtgcttgaaggtactgtatatactccacagaccacaccacaacaatgaccacataaaaagcttcatgataatttctcattccaccctctcat |
35980399 |
T |
 |
| Q |
118 |
gttatcg----aaaacacgttttcaatagtgtatttttgatagatttgaacaatatagaggaacggattgagaaattatcacgctttcattcattatgtg |
213 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35980400 |
gttatcgatcgaaaacacgttttcaatagtgtatttttgatagatttgaacaatatagaggaacggattgagaaattatcatgctttcattcattatgtg |
35980499 |
T |
 |
| Q |
214 |
tctgcgcgcctctatggacatgtt |
237 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35980500 |
tctgcgcgcctctatggacatgtt |
35980523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University