View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_high_26 (Length: 241)
Name: NF4658_high_26
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 4143219 - 4142989
Alignment:
| Q |
1 |
ttttttaattctgcgggaatctatcctgggagtactaggtcgtttccccgagtctagggcaggttactccactgagccgagcggtgttggttgatattaa |
100 |
Q |
| |
|
||||| || |||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4143219 |
tttttgaactctgcgggaatcgaacctgggagtactaggtcgtttccccgagtctagggcaggttactccactgagccgagcggtgttggttgatattaa |
4143120 |
T |
|
| Q |
101 |
acatatgaagcggtttttatgcgattctacatttgaaagttgctcttaaaaattgaaattaacatacatgtcaaaatttt-gnnnnnnnnnaatataaaa |
199 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
4143119 |
acatgtgaagtggtttttatgcgattctacatttgaaagttgctcttaaaaattgaaattagcatacatgtcaaaattttatgttttttttaatataaaa |
4143020 |
T |
|
| Q |
200 |
gatatgttgattgatactatttggaattcat |
230 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
4143019 |
gatatgttgattgataccatttggaattcat |
4142989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University