View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_high_29 (Length: 227)
Name: NF4658_high_29
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_high_29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 49302509 - 49302730
Alignment:
| Q |
7 |
ctgtgaggagacattttactctgaatcagccggctaaaagatttgatgtttttcacatgattttgcactcaatatggctgagaagattgaatataaaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49302509 |
ctgtgaggagacattttactctgaatcagccggctaaaagatttgatgtttttcacatgattttgcactcaatatggctgagaagattgaatataaaact |
49302608 |
T |
 |
| Q |
107 |
gattagttaatctatactaagcataatagagtataccatacactag-atagtgannnnnnnnatttgtaacttttgcttccaataggaataggaactcaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49302609 |
gattagttaatctatactaagcataatagagtataccatacactagtatagtgattttttttatttgtaactttggcttccaataggaataggaactcaa |
49302708 |
T |
 |
| Q |
206 |
atattggcaacaattagtgaca |
227 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
49302709 |
atattggtaacaattagtgaca |
49302730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University