View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_low_17 (Length: 327)
Name: NF4658_low_17
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 129 - 311
Target Start/End: Complemental strand, 54984411 - 54984229
Alignment:
| Q |
129 |
tttcaagaaattctgataagcatttgattaaattttgcattgatcaattggtcttccgtagggagaaatctttggatacaaaatagcataatctttcaca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54984411 |
tttcaagaaattctgataagcatttgattaaattttgcattgatcaattggtcttccgtaaggagaaatctttggatacaaaatagcataatctttcaca |
54984312 |
T |
|
| Q |
229 |
gttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcgacatgtcat |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54984311 |
gttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcgacatgtcat |
54984229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 54984539 - 54984473
Alignment:
| Q |
1 |
attcaaacaccatacaacataaacaccaataaaaacacgactcaacaaaaggtaccaccaacacgaa |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54984539 |
attcaaacaccatacaacataaacaccaataaaaacacgactcaacaaaaggtaccaccaacacgaa |
54984473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 212 - 302
Target Start/End: Original strand, 31320337 - 31320427
Alignment:
| Q |
212 |
tagcataatctttcacagttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcg |
302 |
Q |
| |
|
||||||||||||| || | |||||||||||||||||||||||| ||||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
31320337 |
tagcataatcttttactggtttgtataatactggccttgactcgttcactagtttgtcaatcggttgaatctctttctctgaatttgggcg |
31320427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 216 - 302
Target Start/End: Original strand, 31326377 - 31326463
Alignment:
| Q |
216 |
ataatctttcacagttttgtataatactggccttgactcattcactagtttgtcaattggtttgacctctttctctgaatttgggcg |
302 |
Q |
| |
|
||||||||| || | | ||||| ||| |||||||||||| ||||||||||||||||| |||| | ||||||||| |||| |||||| |
|
|
| T |
31326377 |
ataatcttttactggtctgtatgataatggccttgactcgttcactagtttgtcaatcggttgaatctctttctccgaatctgggcg |
31326463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University