View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_low_18 (Length: 308)
Name: NF4658_low_18
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 298
Target Start/End: Original strand, 26971064 - 26971345
Alignment:
| Q |
17 |
atatataatgtgtagggtgcagagcgggctgggcactagagtaccctacccgcgccccatacccgatcaaatttgcgggtattttcacaagtccagaccc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
26971064 |
atatataatgtgtagggtgcagagcgggctgggcactagagtaccctaattgcgccccatacccgctcaaatttgcgggtattttcataagtccagaccc |
26971163 |
T |
|
| Q |
117 |
agacctaacaatgtgggtatttacatgttcattgtgaataannnnnnngggtgtccattagacttggtctaattaccatccctattcgtcaggaatatgc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
26971164 |
agacctaacaatgtgggtatttacatgttcattgtgaataatttttttgggtgtccattagactttgtctaattaccatccctattcgccgggaatatgc |
26971263 |
T |
|
| Q |
217 |
agtctttagtttagctataatcctttggattgattcaatcatgtatcaatatctgtatgactgtttattttctcaccctatg |
298 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26971264 |
agtctttagtttagctataatcatttggattgattcaatcatgtatcaatatttgtatgactgtttattttctcaccctatg |
26971345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University