View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_low_24 (Length: 253)
Name: NF4658_low_24
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 176 - 250
Target Start/End: Original strand, 43623712 - 43623786
Alignment:
| Q |
176 |
cgtcggtaatgaacagtgttccaatggcaactgtgcatgacacaatgatgcattcgttgctattcatctcactcg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
43623712 |
cgtcggtaatgaacagtgttccaatggcaactgtgcatgacacaatgatgcatttgttgctattcatctctctcg |
43623786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 81 - 143
Target Start/End: Original strand, 43623616 - 43623678
Alignment:
| Q |
81 |
aatgtaaagtttccatattaatctttttaaccaatgtcctatggcactagttaacattcccat |
143 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
43623616 |
aatgtaaagtttttatattaatctttttaaccaatgtcctatgacactagttgacattcccat |
43623678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University