View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_low_27 (Length: 248)
Name: NF4658_low_27
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 3427814 - 3428046
Alignment:
| Q |
1 |
aaccctaaatcttgtcaagtttatattggataaagcatattcaaatgctttaatagggtaacaacaaacacttacacaattgaccaacaaaaatttcatc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3427814 |
aaccctaaatcttgtcaagtctatattggataaagcatatacaaatgctttaatagggtaacaacaaacacttacacaattgaccaacaaaaatttcatc |
3427913 |
T |
|
| Q |
101 |
attcgatccaatattatagttcgcaattgcatatgaattagattacttatgtctttggttatttaattaacttctattgtaatttataataactaaagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3427914 |
attcgatccaatattatagttcgcaattgcatatgaattagattacttatgtctttggttatttaattaacttctattgtaatttataataactaaagaa |
3428013 |
T |
|
| Q |
201 |
atgtttgattcttctttctgatccaactttact |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3428014 |
atgtttgattcttctttctgatccaactttact |
3428046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 177 - 223
Target Start/End: Original strand, 3367309 - 3367355
Alignment:
| Q |
177 |
ttgtaatttataataactaaagaaatgtttgattcttctttctgatc |
223 |
Q |
| |
|
|||||||| |||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
3367309 |
ttgtaattaataataacgatagaaatgtttgattctactttctgatc |
3367355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University