View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4658_low_34 (Length: 218)
Name: NF4658_low_34
Description: NF4658
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4658_low_34 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 49254473 - 49254673
Alignment:
| Q |
18 |
ataggaaaaggcagtgttgttcttctcttaaaaagaaaaggctgtgtaccacatgtcatgtttgtatattagccgatgctttctcttcattccgtgttcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49254473 |
ataggaaaaggcagtgttgttcttctcttaaaaagaaaaggctgtgtaccacatgtcatgtttgtatattagccgatgctttctcttcattccgtgttcg |
49254572 |
T |
|
| Q |
118 |
gagcaaactattacattnnnnnnngttcgttcgagcatcacatgtgaactgaacattgtttattccaatttcaataataatctcaacttccaccaacgta |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49254573 |
gagcaaactattacattaaaaaaagttcgttcgagcatcacatgtgaactgaacattgtttattccaatttcaataataatctcaacttccaccaacgta |
49254672 |
T |
|
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
49254673 |
t |
49254673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University