View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4659-Insertion-12 (Length: 128)
Name: NF4659-Insertion-12
Description: NF4659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4659-Insertion-12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 10 - 128
Target Start/End: Complemental strand, 35113504 - 35113389
Alignment:
| Q |
10 |
atcagcatgtattttaatgtttatagactatagtt-aactattttttcttctgacatggattcatattgatatatataaatacgtacttattgcattata |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
35113504 |
atcagcatgtattttaatgtttatagactatagtttaactattttttcttctgacatggattcatattgatata----aatacgtacttattgcattaga |
35113409 |
T |
 |
| Q |
109 |
tgatgaatgatgcagatcta |
128 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35113408 |
tgatgaatgatgcagatcta |
35113389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University