View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4659-Insertion-13 (Length: 108)
Name: NF4659-Insertion-13
Description: NF4659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4659-Insertion-13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 14817594 - 14817694
Alignment:
| Q |
8 |
ataatgttgtctattattggtccagcgacctttggggattatttgggtttggttcattggttgtgattttctcctccgctcagttcacacaaacccttcg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14817594 |
ataatgttgtctattattggtccagcgacctttggggattatttgggtttggttcattggttatcattttctcctccgctcagttcacccaaacccttcg |
14817693 |
T |
 |
| Q |
108 |
a |
108 |
Q |
| |
|
| |
|
|
| T |
14817694 |
a |
14817694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University