View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4659-Insertion-13 (Length: 108)

Name: NF4659-Insertion-13
Description: NF4659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4659-Insertion-13
NF4659-Insertion-13
[»] chr2 (1 HSPs)
chr2 (8-108)||(14817594-14817694)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 2e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 108
Target Start/End: Original strand, 14817594 - 14817694
Alignment:
8 ataatgttgtctattattggtccagcgacctttggggattatttgggtttggttcattggttgtgattttctcctccgctcagttcacacaaacccttcg 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||    
14817594 ataatgttgtctattattggtccagcgacctttggggattatttgggtttggttcattggttatcattttctcctccgctcagttcacccaaacccttcg 14817693  T
108 a 108  Q
    |    
14817694 a 14817694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University