View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4659_high_12 (Length: 245)
Name: NF4659_high_12
Description: NF4659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4659_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 2654931 - 2654702
Alignment:
| Q |
1 |
ttccaaacaaagtgacgtctcttcaccagtagagcaagtgaaggtggtactaccaattggaaaccatggtttgccgagtgctgaaagtgagggtccttca |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2654931 |
ttccaaacaaagtgatgtctcttcaccagtagagcaagtgaaggtggtactaccaattggaaaccatggtttgccgagtgctgaaagtgagggtccttca |
2654832 |
T |
|
| Q |
101 |
ttgttacttgatcgatggaaacatggtggaggttgcgactgtggtggctgggacatggcctgccctcttattcttttaggcaatcctagtgttcaatttc |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2654831 |
tcgttacttgatcgatggaaacatggtggaggttgcgactgtggtggctgggacatggcctgccctcttattcttttaggcaatcctagtgttcaatttc |
2654732 |
T |
|
| Q |
201 |
atgaagatcgccctcttgtggagaaatatc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2654731 |
atgaagatcgccctcttgtggagaaatatc |
2654702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 39 - 199
Target Start/End: Original strand, 40965576 - 40965736
Alignment:
| Q |
39 |
tgaaggtggtactaccaattggaaaccatggtttgccgagtgctgaaagtgagggtccttcattgttacttgatcgatggaaacatggtggaggttgcga |
138 |
Q |
| |
|
||||||||||| |||| | ||| ||||||||||||| | |||||| | ||||||| |||| |||||||||||||| || ||| || |||||||| || |
|
|
| T |
40965576 |
tgaaggtggtaataccgactggctaccatggtttgccaaacgctgaatgcaagggtccctcatcgttacttgatcgattgagacacggcggaggttgtga |
40965675 |
T |
|
| Q |
139 |
ctgtggtggctgggacatggcctgccctcttattcttttaggcaatcctagtgttcaattt |
199 |
Q |
| |
|
||||||||| |||||||||||||| || ||| | |||||||||||||||||| |||||||| |
|
|
| T |
40965676 |
ctgtggtggttgggacatggcctgtccccttgtacttttaggcaatcctagtattcaattt |
40965736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University