View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4659_high_7 (Length: 282)
Name: NF4659_high_7
Description: NF4659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4659_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 87 - 264
Target Start/End: Original strand, 49315537 - 49315714
Alignment:
| Q |
87 |
gctggtttggacattagggcgcacgatactatcttgcgccttttttccttcttctccttcgtcactgtgtggcgtatgatagtaaaccatgcgcgtttct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49315537 |
gctggtttggacattagggcgcacgatactatcttgcgccttttttccttcttctccttcgtcactgtgtggcgtatgatagtaaaccatgcgcgtttct |
49315636 |
T |
 |
| Q |
187 |
tgtttgattggttgggttaagatgtactagagtatgcgtgttactaaatatggactgtttgtggccgttggatctgtg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
49315637 |
tgtttgattggttgggttaagatgtactagagtatgcgtgttactaaatatggactgtttgtggccgttggatttgtg |
49315714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University