View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4659_high_7 (Length: 282)

Name: NF4659_high_7
Description: NF4659
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4659_high_7
NF4659_high_7
[»] chr3 (1 HSPs)
chr3 (87-264)||(49315537-49315714)


Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 87 - 264
Target Start/End: Original strand, 49315537 - 49315714
Alignment:
87 gctggtttggacattagggcgcacgatactatcttgcgccttttttccttcttctccttcgtcactgtgtggcgtatgatagtaaaccatgcgcgtttct 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49315537 gctggtttggacattagggcgcacgatactatcttgcgccttttttccttcttctccttcgtcactgtgtggcgtatgatagtaaaccatgcgcgtttct 49315636  T
187 tgtttgattggttgggttaagatgtactagagtatgcgtgttactaaatatggactgtttgtggccgttggatctgtg 264  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
49315637 tgtttgattggttgggttaagatgtactagagtatgcgtgttactaaatatggactgtttgtggccgttggatttgtg 49315714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University