View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660-Insertion-11 (Length: 155)
Name: NF4660-Insertion-11
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660-Insertion-11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 5e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 32229821 - 32229943
Alignment:
| Q |
8 |
cattggttggctaataagattgaaataatgatataacatatataacatgtgtgtgggtgaaaataagttccttaaggagatatttaactcatgttactct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
32229821 |
cattggttggctaataagattgaaataatgatataacata----acatgtgtgtgggtgaaaataaattccttaaggagatatttaactcatgttcctct |
32229916 |
T |
 |
| Q |
108 |
actattaccttgactttcgatatgata |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32229917 |
actattaccttgactttcgatatgata |
32229943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University