View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660-Insertion-14 (Length: 151)
Name: NF4660-Insertion-14
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660-Insertion-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 7 - 151
Target Start/End: Complemental strand, 44358251 - 44358107
Alignment:
| Q |
7 |
atcaagtatacggtggagtgccatatatacgctctgctgaagacattgcatttcatgtcactctttttgttgcaagaaatggaagctttgtcaactacta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44358251 |
atcaagtatacggtggagtgccatatatacgctctgctgaagacattgcatttcatgtcactctttttgttgcaagaaatggaagctttgtcaactacta |
44358152 |
T |
 |
| Q |
107 |
tatggtactattcttcatttaagcttattttatttgcattattca |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44358151 |
tatggtactattcttcatttaagcttattttatttgcattattca |
44358107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 39476407 - 39476340
Alignment:
| Q |
18 |
ggtggagtgccatatatacgctctgctgaagacattgcatttcatgtcactctttttgttgcaagaaa |
85 |
Q |
| |
|
||||||| |||||||||| | ||||| |||||| |||||| |||||||||||||| |||||||||| |
|
|
| T |
39476407 |
ggtggagagccatatataagatctgccaaagacactgcattccatgtcactcttttcattgcaagaaa |
39476340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University