View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660-Insertion-19 (Length: 147)
Name: NF4660-Insertion-19
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660-Insertion-19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 5e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 5e-48
Query Start/End: Original strand, 12 - 116
Target Start/End: Complemental strand, 49210706 - 49210602
Alignment:
| Q |
12 |
acaataaaatatcttagaagttaaaacattttcttttcttatatatagagtagactaaaatattgtttaaacgttttagaattcgtaatttgcttcgact |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49210706 |
acaataaaatatcttagaagttaaaacattttattttcttatatatagagtagactaaaatattgtttaaaagttttagaattcgtaatttgcttcgact |
49210607 |
T |
 |
| Q |
112 |
gttaa |
116 |
Q |
| |
|
||||| |
|
|
| T |
49210606 |
gttaa |
49210602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University