View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660-Insertion-8 (Length: 171)
Name: NF4660-Insertion-8
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660-Insertion-8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 5e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 5e-70
Query Start/End: Original strand, 8 - 171
Target Start/End: Original strand, 8742401 - 8742563
Alignment:
| Q |
8 |
ggaagtagctaattatcaagnnnnnnngtcatttatgtcaagttaaatgtgtatctgaaggttggtttatgaataccgttggtaggcataatggatttgt |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742401 |
ggaagtagctaattatcaagtttttt-gtcatttatgtcaaattaaatgtgtatctgaaggttggtttatgaataccgttggtaggcataatggatttgt |
8742499 |
T |
 |
| Q |
108 |
tagttagtttagtatgtcttcagagtttgtgaaattgtattttggactgcagtgatttagtgtt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8742500 |
tagttagtttagtatgtcttcagagtttgtgaaattgtattttggactgcagtgatttagtgtt |
8742563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University