View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_high_22 (Length: 277)
Name: NF4660_high_22
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_high_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 19 - 245
Target Start/End: Complemental strand, 6985379 - 6985151
Alignment:
| Q |
19 |
aatttagatcaaacccaaactctctggtttaat-agttttgtaaatgatttt-atatgaatctcttggtaattgagggtttggtaagatccatgtggtgg |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6985379 |
aatttagatcaaacccaaattctctggtttaattagttttgtaaatgatttttatatgaatctcttggtaattgagggtttggtaagatccatgtggtgg |
6985280 |
T |
|
| Q |
117 |
gtgtttgttaattgnnnnnnnnnnnnnggtacataggtttatttgttagttgtaattgttgaaagttatgannnnnnncatacaatgttgaaaacttttg |
216 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6985279 |
gtgtttgttaattgtttttttatttttggtacataggtgtatttgttagttgttattgttgaaagttatgatttttttcatacaatgttgaaaactttta |
6985180 |
T |
|
| Q |
217 |
gaagaaatatggaccatgaaaaattaagg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6985179 |
gaagaaatatggaccatgaaaaattaagg |
6985151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University