View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4660_high_24 (Length: 256)

Name: NF4660_high_24
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4660_high_24
NF4660_high_24
[»] chr1 (2 HSPs)
chr1 (136-229)||(6700503-6700596)
chr1 (1-31)||(6700388-6700418)


Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 136 - 229
Target Start/End: Original strand, 6700503 - 6700596
Alignment:
136 tacaacttcgtatagtgcgttacaacaccactttttaatttagaaattttagatatggtggtctaatcctcttatgtgtttgggagttgctact 229  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||  |||||||||||||||    
6700503 tacaacttcgtatagggcgttacaacaccactttttaatttagaaattttagatatgatggcctaatcctcttatgtacttgggagttgctact 6700596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 6700388 - 6700418
Alignment:
1 tcatacgatgtgatatgatcaacatatatga 31  Q
    |||||||||||||||||||||||||||||||    
6700388 tcatacgatgtgatatgatcaacatatatga 6700418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University