View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_high_24 (Length: 256)
Name: NF4660_high_24
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 136 - 229
Target Start/End: Original strand, 6700503 - 6700596
Alignment:
| Q |
136 |
tacaacttcgtatagtgcgttacaacaccactttttaatttagaaattttagatatggtggtctaatcctcttatgtgtttgggagttgctact |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
6700503 |
tacaacttcgtatagggcgttacaacaccactttttaatttagaaattttagatatgatggcctaatcctcttatgtacttgggagttgctact |
6700596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 6700388 - 6700418
Alignment:
| Q |
1 |
tcatacgatgtgatatgatcaacatatatga |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6700388 |
tcatacgatgtgatatgatcaacatatatga |
6700418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University