View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_high_30 (Length: 250)
Name: NF4660_high_30
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_high_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 6 - 226
Target Start/End: Original strand, 49325891 - 49326111
Alignment:
| Q |
6 |
aggagcagagatggaaacgtgctcaagggttttcaaagaaattgacgggtttcgaaaaattggagaagaaacttctaaccaagggataatatagtggcga |
105 |
Q |
| |
|
|||| |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
49325891 |
aggaacagaaatggaaacgtgctcaagagttttcaaagaaattgacgggtttcgaaaaattggagaagaaactcctaaccaagggataatacagcggcga |
49325990 |
T |
 |
| Q |
106 |
cattgggtggtgcagcgatgcaaccacgacgaatttcacagctaaatcaggggaaggcgtgtatcttgcagtagcgatcccttcatgtactattttaagg |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49325991 |
cattgggtggtgcagcgatgcaaccacaacgaatctcacggctaaatcaggggaaggcgtgtatcttgcagtagtgatcccttcatgtactattttaagg |
49326090 |
T |
 |
| Q |
206 |
attaaaattatggtttctata |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49326091 |
attaaaattatggtttctata |
49326111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University