View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_high_31 (Length: 250)
Name: NF4660_high_31
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 238
Target Start/End: Original strand, 3809502 - 3809726
Alignment:
| Q |
14 |
gacatggaaaactacacagtccaggggtaatatcacgagtagctttactatacgatgttcatagaagtatcatttttcgtatatggaaacaagtaatgga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3809502 |
gacatggaaaactacacagtccaggggtaatatcccgagcagctttactatacgatgttcatagaagtatcatttatcgtatatggaaacaagtaatgga |
3809601 |
T |
 |
| Q |
114 |
gactggtaatgcttatcataagaaaacacgctgtggaaggaaacgtgttcagttagatttggagttaatgcgtcaagttccattgtcaaaacgatctacc |
213 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3809602 |
gactggtaatgcttatcataagaaaaaacgatgtggaaggaaatgtgttcagttagatttggagttaatgcgtcaagttccattgtcaaaacgatctacc |
3809701 |
T |
 |
| Q |
214 |
tttcgatctctatctcttgctctga |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3809702 |
tttcgatctctatctcttgctctga |
3809726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University