View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_high_32 (Length: 244)
Name: NF4660_high_32
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_high_32 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 57 - 182
Target Start/End: Complemental strand, 16833947 - 16833822
Alignment:
| Q |
57 |
cgtccacggaaatgttaaagaaaaccttaacaacctattgtatcgatgatagtacaaatgagtcaactcaatgaattatatactaactgactatattttt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |||| |
|
|
| T |
16833947 |
cgtccacggaaatgttaaagaaaaccttaacaacctattgtatcgatgatagtacaaatgagttaactcaataaattatatactaactgactataatttt |
16833848 |
T |
|
| Q |
157 |
aacacttattaaccaaggtctataca |
182 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16833847 |
aacacttattaaccaaggtctataca |
16833822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University