View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_high_35 (Length: 237)
Name: NF4660_high_35
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_high_35 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 237
Target Start/End: Complemental strand, 23051905 - 23051683
Alignment:
| Q |
15 |
atttttatcctgatttgcctaaagggtatcagatttcgcaatttgatgttccgattgcgagttctgggtttcttgatgttgatattcctttggagtatgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23051905 |
atttttatcctgatttgcctaaagggtatcagatttcgcaatttgatgttccgattgcgagttctgggtttcttgatgttgatattcctttggagtatgg |
23051806 |
T |
 |
| Q |
115 |
tggtgggcataagaggtttgggattactagggttcatatggaagaggatgctgggaagttattgcatactgaaaatgggaattattctcaggtagtgttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23051805 |
tggtgggcataagaggtttgggattactagggttcatatggaagaggatgctgggaagttattgcatactgaaaatgggaattattctcaggtagtgttt |
23051706 |
T |
 |
| Q |
215 |
ctttgtttcttctcatttgttct |
237 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
23051705 |
ctttgtttcttctcatttgttct |
23051683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University