View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_high_42 (Length: 208)
Name: NF4660_high_42
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_high_42 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 37 - 194
Target Start/End: Complemental strand, 3809412 - 3809253
Alignment:
| Q |
37 |
tcattcttcagaaaacgacgttttttggaagttccttcagttgtcaacgagtctgcatgacaagattaaaggg-aaaaaatatcgaaattcaattgata- |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
3809412 |
tcattcttcagaaaacgacgttttttggaagttccttcagttgtcaacgagtctgcatgacaagattatagggaaaaaaatatcgaaattcaattgatat |
3809313 |
T |
 |
| Q |
135 |
-tatcaactaaaaataacagggcacaaaaaagggaagaatatgtgtcattctactttaaac |
194 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3809312 |
ttatcaactaaaaataaca-agcacaaaaaagggaagaatatgtgtcattctactttaaac |
3809253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University