View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_low_31 (Length: 251)
Name: NF4660_low_31
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_low_31 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 23051250 - 23051494
Alignment:
| Q |
8 |
caccacagagatcacaatttaaaataggaatactgnnnnnnnnnn-aatatttaacactccctttgttgttaaacactcattattggaggaatcaggcca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23051250 |
caccacagagatcacaatttaaaataggaatactgtttttttttttaatatttaacactccctttgttgttaaacactcattattggaggaatcaggcca |
23051349 |
T |
 |
| Q |
107 |
atgatcttcctcatttaccaatggtaatgtggtcaaagcatagtttgagcaatgtaatttgcaattttcagccttgtggcatgcattttaagattcaaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23051350 |
atgatcttcctcatttaccaatggtaatgtggtcaaagcatagtttgagcaatgtaatttgcaattttcagccttgtggcatgcattttaagattcaaca |
23051449 |
T |
 |
| Q |
207 |
tacttcacaaactcggttaaataagttgtctaaacagtttctttt |
251 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23051450 |
tacttcacaaactcagttaaataagttgtctaaacagtttctttt |
23051494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University