View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_low_42 (Length: 215)
Name: NF4660_low_42
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 90 - 199
Target Start/End: Original strand, 30547209 - 30547318
Alignment:
| Q |
90 |
cttaacggtgagactgagggtgtaataagctttggccatatggtaccgaatctgcgtccacctcgaaaccattgttggaacaaaactcttttcttattcc |
189 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30547209 |
cttaacggtgagatcgagggtgtaacaagctttggccataaggtaccgaatctgcgtccgcctcgaaaccattgttggaacaaaactcttttcttattcc |
30547308 |
T |
 |
| Q |
190 |
tttttattta |
199 |
Q |
| |
|
|||||||||| |
|
|
| T |
30547309 |
tttttattta |
30547318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 11612429 - 11612380
Alignment:
| Q |
16 |
atgaatcaatagggacacatgaaaaaagagaagagagtactaacatatga |
65 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612429 |
atgaatcaatagtgacacatgaaaaaagagaagagagtactaacatatga |
11612380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University