View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4660_low_42 (Length: 215)

Name: NF4660_low_42
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4660_low_42
NF4660_low_42
[»] chr1 (1 HSPs)
chr1 (90-199)||(30547209-30547318)
[»] chr8 (1 HSPs)
chr8 (16-65)||(11612380-11612429)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 90 - 199
Target Start/End: Original strand, 30547209 - 30547318
Alignment:
90 cttaacggtgagactgagggtgtaataagctttggccatatggtaccgaatctgcgtccacctcgaaaccattgttggaacaaaactcttttcttattcc 189  Q
    |||||||||||||  |||||||||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
30547209 cttaacggtgagatcgagggtgtaacaagctttggccataaggtaccgaatctgcgtccgcctcgaaaccattgttggaacaaaactcttttcttattcc 30547308  T
190 tttttattta 199  Q
    ||||||||||    
30547309 tttttattta 30547318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 65
Target Start/End: Complemental strand, 11612429 - 11612380
Alignment:
16 atgaatcaatagggacacatgaaaaaagagaagagagtactaacatatga 65  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||    
11612429 atgaatcaatagtgacacatgaaaaaagagaagagagtactaacatatga 11612380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University