View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4660_low_45 (Length: 202)
Name: NF4660_low_45
Description: NF4660
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4660_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 55896477 - 55896647
Alignment:
| Q |
14 |
attattctactcaaaacacacaaggccaacgtaagcctcaacatgatggtgctaaaattgtctcctccttccctttgctttgtgtagattcttcaatcgg |
113 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55896477 |
attatgctactcaaaacacacaaggccaacgtaagcctcaacatgatggtgctaaaattgtctcctccttccctttgctttgtgtagattcttcaatcgg |
55896576 |
T |
 |
| Q |
114 |
ttgcttttgcttttggccaaactcaaagggatcttttattgtttatttctttcttgttgtgatgtaaatac |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55896577 |
ttgcttttgcttttggccaaactcaaagggatcttttattgtttatttctttcttgttgtgatgtaaatac |
55896647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 1028500 - 1028447
Alignment:
| Q |
131 |
caaactcaaagggatcttttattgtttatttctttcttgttgtgatgtaaatac |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1028500 |
caaactcaaagggatcttttattgtttatttctttcttgttgtgatgtaaatac |
1028447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 93 - 122
Target Start/End: Complemental strand, 1028554 - 1028525
Alignment:
| Q |
93 |
ttgtgtagattcttcaatcggttgcttttg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1028554 |
ttgtgtagattcttcaatcggttgcttttg |
1028525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University