View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4661-Insertion-10 (Length: 160)
Name: NF4661-Insertion-10
Description: NF4661
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4661-Insertion-10 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 92; Significance: 5e-45; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 92; E-Value: 5e-45
Query Start/End: Original strand, 69 - 160
Target Start/End: Complemental strand, 37961603 - 37961512
Alignment:
| Q |
69 |
tcacgagaccaagttcaccatgaaggtgatagaacatagtcaagttgcaccaccaccaaattcacttacatcaccaaccattctacccttaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37961603 |
tcacgagaccaagttcaccatgaaggtgatagaacatagtcaagttgcaccaccaccaaattcacttacatcaccaaccattctacccttaa |
37961512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 4e-18
Query Start/End: Original strand, 88 - 146
Target Start/End: Original strand, 37906481 - 37906539
Alignment:
| Q |
88 |
atgaaggtgatagaacatagtcaagttgcaccaccaccaaattcacttacatcaccaac |
146 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37906481 |
atgaaggtaatagaacatagccaagttgcaccaccaccaaattcacttccatcaccaac |
37906539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 88 - 146
Target Start/End: Original strand, 37914644 - 37914702
Alignment:
| Q |
88 |
atgaaggtgatagaacatagtcaagttgcaccaccaccaaattcacttacatcaccaac |
146 |
Q |
| |
|
|||||||||||||| || | |||| || |||||||||||| ||||||| |||||||||| |
|
|
| T |
37914644 |
atgaaggtgatagagcagactcaaatttcaccaccaccaagttcacttccatcaccaac |
37914702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University